vetmed

PAPER SELECTED

In-Vitro Amplification of Genome Fragment of Bovine Viral Diarthoea-Mucosal Disease (Bvd-Md) by Pcr Method

VILCEK S
Veterinarni Medicina 38, 1993, 257-266

DNA in-vitro amplification when a PCR (polymerase chain reaction) method is used (S a i k i et al., 1985) provides for a simple technique of marked amplification of a selected DNA fragment. The length of a DNA amplified fragment is determined by two synthetic primers which spontaneously (at an appropriate temperature) hybridize with the opposite ends of antiparallelly oriented strains of denatured DNA. The enzyme Taq polymerase completes the synthetisation of new DNA strains from the primers. Repetition of these cycles (denaturing, primer bonds, DNA synthesis) enhances the DNA amplification of a defined strain length to such an extent that is possible to prove this process by e.g. electrophoretic analysis. For the purposes of a proof of BVD-MD genome in cattle the fragment 315 bp was chosen from the virus-coding gene gp 80. The primers P1 - 5 - GTAGGTAGAGTGAAACCCGG - 3' and P2 - 5' - CGGGACCTGGACTTCATAGC - 3'(Hertig et al., 1991) determined the length of the amplified fragment. Virus RNA was isolated from the infectious BVD-MD-containing medium (Ph strain) using a phenol-chloroform (1:1) mixture, and before amplification it was transcribed to cDNA in the P2 presence by the effect of AMV reverse transcriptase. cDNA without isolation from the transcription reaction mixture was directly used for PCR. DNA was denatured at 94-degrees-C for 10 minutes before the outset of amplification. These reaction conditions are suitable for the PCR method: P1 and P2 primer concentrations per 100 mul reaction solution - 1 muM, dNTP - 100 muM 2 - 4 U Taq polymerase, 25 - 35 amplification cycles with the temperature regime: 94-degrees-C/I min, 56-degrees-C/1 min, 73-degrees-C/l min, and prolonged incubation 73-degrees-C/7 min in the last cycle. Proof of the amplified product 315 bp DNA - electrophoretic analysis of 1.5 to 2% agarose gel in TAE buffer and ethidium bromide staining of gel are suitable. The introduced PCR method gives opportunities for innovations of BVD-MD diagnosis in cattle on the basis of virus genome proof without any cell cultivation need


FULL PAPER on request
« back